The most widely accepted model proposes that familial breast cancer susceptibility is a consequence of a small number of mutations in BRCA1 or BRCA2 (BRCA1/2) and a much higher proportion of mutations in ethnic-specific genes of moderate and/or low penetrance [1]. CHEK2 gene, involved in DNA damage and replication checkpoints, has been pointed out as a good candidate. Moreover, a specific variant in this gene, 1100delC, has been found to increase breast cancer susceptibility among familial breast cancer cases not attributable to mutations in BRCA1/2 [2]. Most of the studies evaluating this mutation as a female breast cancer susceptibility allele have been conducted in European populations, where the prevalence of the variant in controls ranged from 0 out of 400 controls in Spain to 2.8% in the Netherlands (Table 1). This variant has been detected in a considerable higher proportion (4–11%) in patients with a positive family history of breast cancer (usually known to be BRCA1/2 mutation-negative) from Northern Europe (Table 1) This variant has been estimated to be associated with an approximately 1.5–2.0 fold increased risk in female breast cancer cases with a positive family history [4–6]. CHEK2 has not been well studied in other ethnic groups. In our laboratory, we evaluated the 1100delC mutation in 3 Chilean groups: (a) 196 breast cancer patients belonging to high risk Chilean families of which 184 were BRCA1/2 negatives [21]; (b) a control group of 500 healthy Chilean females with no personal or familial history of breast or other cancer. Cases and controls were matched by age and ethnic background; (c) the third group included 624 healthy Chilean females but with at least two relatives in first or second degree with breast cancer. This study was approved by the Institutional Review Board of the School of Medicine of the University of Chile. Informed consent was obtained from all the participants. No other mutations in the CHEK2 gene have been studied because it seems that the 1100delC is the only CHEK2 allele that makes an appreciable contribution to breast cancer susceptibility [22]. Genomic DNA extracted from blood was genotyped for CHEK2 1100delC by restriction fragment length polymorphisms (RFLP). PCR was carried out using oligonucleotides 50 CTTTTGCACTGAATTTTAGAGTA 30 and 50 ACCTCCTACCAGTCTGTGC 30, which specifically amplify exon 10 from the functional copy of CHEK2 on chromosome 22, relative to the non-functional pseudogenes [16]. The PCR product was digested with RsaI Grant support: FONDECYT 1060094, CONAC.